The Infona portal uses cookies, i.e. strings of text saved by a browser on the user's device. The portal can access those files and use them to remember the user's data, such as their chosen settings (screen view, interface language, etc.), or their login data. By using the Infona portal the user accepts automatic saving and using this information for portal operation purposes. More information on the subject can be found in the Privacy Policy and Terms of Service. By closing this window the user confirms that they have read the information on cookie usage, and they accept the privacy policy and the way cookies are used by the portal. You can change the cookie settings in your browser.
We analyzed the participation of a predominant B cell clonotype in the anti-arsonate immune response of mice in which Bcl-2 expression was enforced in B cells. Many of the antibodies expressed by the arsonate-induced memory compartment of these mice were ''dual-reactive,'' displaying increased affinity acquired via V region somatic hypermutation for both arsonate and the autoantigen DNA. The hypermutated...
We previously showed that a variety of amino acid substitutions at positions 58 and 59 in the V H CDR2 of an anti-arsonate (Ars) antibody Fab simultaneously resulted in increased or unaltered affinity for Ars and substantially enhanced affinity for DNA. To test the generality of these observations, we generated and characterized several antibody phage display libraries of this Fab containing...
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCA-DAGCGCAψUUGUUUUGGNψFACAAAAUmsu7GUCACGGGTψCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNAPro (UGG), the other two known plant organellar tRNAsPro.
Set the date range to filter the displayed results. You can set a starting date, ending date or both. You can enter the dates manually or choose them from the calendar.