The Infona portal uses cookies, i.e. strings of text saved by a browser on the user's device. The portal can access those files and use them to remember the user's data, such as their chosen settings (screen view, interface language, etc.), or their login data. By using the Infona portal the user accepts automatic saving and using this information for portal operation purposes. More information on the subject can be found in the Privacy Policy and Terms of Service. By closing this window the user confirms that they have read the information on cookie usage, and they accept the privacy policy and the way cookies are used by the portal. You can change the cookie settings in your browser.
In current studies we use the oligonucleotides based on c-myc sequence: CCC CAC CCT CCC CAC CCT CCC C (cmyc22) and CCC CAC CCT CCC CAC CCT CCC CA (cmyc22A) functionalized by pyrene moieties at both termini. Results of the circular dichroism (CD), UV absorption melting experiments, and steady-state fluorescence measurements of pyrene-modified i-motifs as well as their unlabeled precursors are presented...
We report steady state fluorescence and lifetime emission studies of d(GGTTGGTGTGGTTGG) (TBA) and d(GGGTTAGGGTTAGGGTTAGGG) (Htelom) oligonucleotides labeled with pyrene through a 3-aminopropyl linker. Such G-rich sequences are able to self-assemble into G-quadruplexes, especially in the presence of specific cations like potassium. A comparative studies with single- and double-labeled G-quadruplexes...
Set the date range to filter the displayed results. You can set a starting date, ending date or both. You can enter the dates manually or choose them from the calendar.