The Infona portal uses cookies, i.e. strings of text saved by a browser on the user's device. The portal can access those files and use them to remember the user's data, such as their chosen settings (screen view, interface language, etc.), or their login data. By using the Infona portal the user accepts automatic saving and using this information for portal operation purposes. More information on the subject can be found in the Privacy Policy and Terms of Service. By closing this window the user confirms that they have read the information on cookie usage, and they accept the privacy policy and the way cookies are used by the portal. You can change the cookie settings in your browser.
An i‐motif is a non‐canonical DNA structure implicated in gene regulation and linked to cancers. The C‐rich strand of the HRAS oncogene, 5′‐CGCCCGTGCCCTGCGCCCGCAACCCGA‐3′ (herein referred to as iHRAS), forms an i‐motif in vitro but its exact structure was unknown. HRAS is a member of the RAS proto‐oncogene family. About 19 % of US cancer patients carry mutations in RAS genes. We solved the structure...