The Infona portal uses cookies, i.e. strings of text saved by a browser on the user's device. The portal can access those files and use them to remember the user's data, such as their chosen settings (screen view, interface language, etc.), or their login data. By using the Infona portal the user accepts automatic saving and using this information for portal operation purposes. More information on the subject can be found in the Privacy Policy and Terms of Service. By closing this window the user confirms that they have read the information on cookie usage, and they accept the privacy policy and the way cookies are used by the portal. You can change the cookie settings in your browser.
The aim of this study was to elucidate the influence of ethanol on concentrations of lead in tissues of rats exposed to lead acetate. The experiment was made on Wistar rats. The animals were given lead acetate (500 mg 1-1 of lead) in drinking water for 6 weeks. For 4 to 5 days before the end of exposure to lead, the animals were given intragastrically 25% solution of ethanol in doses of 5 g/kg body...
The organophosphorus insecticide bromfenvinfos (2-bromo-l-(2,4-dichlorophenyl)vinyl diethyl phosphate) and its methylated homologue methylbromfenvinfos inhibited noncompetitively the activity of (Ca2+ + Mg2+)-ATPase bound to and solubilized from pig erythrocyte membrane. Both enzyme preparations exhibited biphasic substrate curves displaying the existence of two functional active sites with low and...
The concentrations of dissolved organic compounds (DOC) in the waters of small and large agricultural drainage basins were analyzed. It was found that the average DOC concentrations in surface water of the large agricultural drainage basin was 15.6 mg/1. Much higher DOC concentrations were noted in ground and surface waters of the small agricultural drainage basin. Groundwater under a cultivated field...
Quantitative determination of dioctyl the phthalate [bis (2-ethylhexyl) phthalate, DEHP] pollutant in soil and surface water near the "ERG" Factory of Synthetic Polymers located in Wąbrzeźno (Toruń District) has been carried out. Results confirm a high concentration of DEHP in the soil (max. 45 g/kg of air-dry soil). DEHP was also found in the water and bottom muds of Sitno Lake, near Wąbrzeźno...
We evaluated morphological changes, the activities of succinate dehydrogenase, lactate dehydrogenase, glucoso-6-phosphatase, Mg2+-dependent adenosine triphosphatase, and acid phosphatase, and the activity of the cytochrome P-450-dependent monooxygenase system in rat kidneys exposed to coal dusts containing either low or high amounts of heavy metals. We showed that the coal dust with a very low content...
Under light stress of 1000 /imol s-1m-2 (λ=400 - 700 nm) for 140 min cyanobacteria mats of "tintenstrich" formations on limestone rocks of Kobylaňska-Valley, west of Cracow, Poland showed reduction of the potential and eiTective quantum yield variables ∆F/Fm' and Fv/Fm3, respectively of PSII and the samples first recovered partly after six days. Also, the Fo level, known to be affected by...
The effect of a concentration of heavy metal ions (Pb2+, Cd2+, Hg2 + and Zn2+) on the process of dissimilative reduction of sulfates in medium containing active Desulphotomaculum ruminis bacteria was studied. Both tolerable and toxic concentrations of the mentioned ions were determined. According to the degree of their toxicity the following ion sequence was established: Cd2 + > Zn2+ > Hg2+...
The aim of this review is to introduce some principle areas of biosensor research and illustrate current technology with selected examples, including physico-chemical transducers and biological materials used for analytical active layers.
The contamination of the city of Lublin by gamma emitters and contents of radionuclides in the ground layer of air were studied. A heterogeneous distribution of radiocesium was found in soils, due chiefly to the Chernobyl power plant accident The contribution of afiter-Chernobyl radiocesium to the total amount of this radioelement in the surface layer of the soil averages 85%. Compared with so-called...
For three months rat livers absorbed coal dust containing low or high concentrations of heavy metals. We found that these concentrations of heavy metals significantly decrease cytochrome P-450 content in hepatic microsomes, and that this decrease correlates with the concentration of heavy metals. Furthermore, we have shown that only coal dust with high heavy metal content produces such structural...
We analyzed the content of mercury in the bones of people living in a highly industrial region and therefore exposed to heavy metals. Cold vapour atomic absorption spectrometry was used to determine mercury while the samples were prepared using the mineralization by microwave digestion system. In analyzed samples mercury values lower than 5 ng to 0.26 ppm were found. In bone samples taken from people...
The effects of lead salts (chloride, nitrate, acetate) on the elongation growth of three cereal species (maize, wheat, rye) under the same growth conditions were studied. It has been found that the most toxic lead compound for maize was acetate, while the most sensitive to lead chloride was wheat. It is suggested that in order to obtain comparable results in experiments on the effects of different...
This paper presents studies on the effects of manganese, barium, zinc, aluminium and copper ions on the rate of biological sulfates reduction by Desulfotomaculum ruminis bacteria. We determinated the concentrations of these ions which totally inhibited the process. The anions we studied can be arranged according to increasing poisonous properties: Mn2+
Pods of some roadside plants such as Albizia lebbeck, Pongamia pinnata, Dalbergia sissoo, Leucaena leucncephala, Parkensonia aculeata, Sesbania sesban and Tecoma stans collected from the city area showed significant decreases in weight and length as compared to pods collected from a clean area. Azadirachta indica, Delonix regia and Peltophorum pterocarpum showed enhancement in pod weight or length...
Studies were carried out on the effect of various methods of storing municipal refuse upon the survival and passage of saprophytic microorganisms (TVC, Gram positive bacteria, Gram negative bacteria, thermotolerants, yeasts), bacteria indicative of sanitary conditions (TC, FC, E. coli, FS, enterococci, Clostridium perfringens) and opportunistic pathogens (hemolytic streptococci, staphylococci, in...
The interaction of methylbromfenvinfos with model and native membranes was investigated using fluorescence anisotropy of 1,6-diphenyl-1,3,5-hexatriene (DPH), a probe located in the hydrophobic core of the bilayer and l,3-bis-(l-pyrene) propane, a probe distributed in the outer region of the bilayer. DPH reported a broadening of the transition profile and solidifying effects in the fluid phase of liposomes...
This work presents basic information on preparing previously handled samples of soils and sediments in order to determine low concentrations of different organic contaminants (Volatile Organic Compounds (VOCs), Polychlorinated Biphenyls (PCBs), Polychlorinated Aromatic Hydrocarbons (PAHs), pesticides, and Polychlorinated Dibenzo-p-dioxins and Polychlorinated Dibenzofurans (PCDD/F), etc.). Solid environmental...
The possibility of using the monoionic Ag+ - form of clinoptilolite of domestic origin for radioactive iodide separation from waters has heen studied. The capacity of the silver form of clinoptilolite towards iodide exceeds many times that of the capacity of clinoptilolite in natural form. Due to low solubility the product Agl iodides generate precipitates on the surface of zeolite. SEM and rtg analyses...
We evaluated morphological changes, the activities of succinate dehydrogenase, lactate dehydrogenase, glucose-6-phosphatase, Mg2+ -dependent adenosine triphosphatase, and acid phosphatase, and the activity of the cytochrome P-450-dependent monooxygenase system in the kidneys of rats exposed to coal dusts containing either very low or high amounts of heavy metals. We showed that the coal dust with...
The interaction of the commonly used organophosphorus insecticide dichlorvos (2,2-dichlorovinyl dimethyl phosphate) with synthetic and mammalian DNA was investigated by spectroscopic techniques. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and synthetic two-stranded oligomer of sequence 5' - d(TTGGATCCGAATTCAAGCTT)-3' Melting curves and circular dichroism spectra were taken for the DNAs...
Set the date range to filter the displayed results. You can set a starting date, ending date or both. You can enter the dates manually or choose them from the calendar.