The Infona portal uses cookies, i.e. strings of text saved by a browser on the user's device. The portal can access those files and use them to remember the user's data, such as their chosen settings (screen view, interface language, etc.), or their login data. By using the Infona portal the user accepts automatic saving and using this information for portal operation purposes. More information on the subject can be found in the Privacy Policy and Terms of Service. By closing this window the user confirms that they have read the information on cookie usage, and they accept the privacy policy and the way cookies are used by the portal. You can change the cookie settings in your browser.
The most frequent type of rhizomelic dwarfism, achondroplasia (ACH), is caused by mutations in the fibroblast growth factor receptor 3 (FGFR3) gene. Mutations in FGFR3 result in skeletal dysplasias of variable severity, including mild phenotypic effects in hypochondroplasia (HCH), severe phenotypic effects in thanatophoric dysplasia types I (TDI) and II (TDII), and severe but survivable phenotypic...
Achondroplasia (Ach), the most common form of short-limb short stature, and related disorders are caused by constitutively active point mutations in the fibroblast growth factor receptor 3 (FGFR3) gene. Recent studies have provided a large body of evidence for the role of the proliferation and differentiation of chondrocytes in these disorders. Furthermore, a G380R mutation in FGFR3 (FGFR3 Ach...
Cartilage-hair hypoplasia (CHH) is an autosomal recessive metaphyseal chondrodysplasia characterized by severe short-limb short stature and hypoplastic hair.The responsible gene for CHH has been identified to be ribonuclease of mitochondrial RNA-processing (RMRP) gene. We examined RMRP genes of a 3-year-old Japanese CHH boy and his family and revealed a novel mutation: 20 bp duplication (TACTCTGTGAAGCTGAGGAC),...
Set the date range to filter the displayed results. You can set a starting date, ending date or both. You can enter the dates manually or choose them from the calendar.